KOSEN 한인과학기술자네트워크

닫기

더 많은 혜택을 위해
로그인 하세요.

지식나눔

지식나눔

melting temperature (RACE PCR primer)가 궁금합니다

2013-12-31 org.kosen.entty.User@30a060a4 정명철(audcjf6)
  • 1
3 prime RACE PCR과 5' RACE PCR의 각각의 primer를 자려고 하는데요 

primer melting temperature가 어느 정도가 적정한지 min, max까지 알고 싶습니다
  • RACE pcr
  • Primer
  • melting temperature
지식의 출발은 질문, 모든 지식의 완성은 답변! 
각 분야 한인연구자와 현업 전문가분들의 답변을 기다립니다.
답변하기
답변 1
  • 답변

    이배훈님의 답변

    2013-12-31
    • 0

    첨부파일

    Primer의 길이와 염기서열이 증폭을 성공적으로 해낼 수 있는 가장 중요한
    관건이다. 핵산의 녹는점 (Tm) (여기서 녹는다는 의미는 두 가닥이 반 쯤 분리
    되는 것을 의미함)은 길이가 길수록, 그리고 (G+C)의 양이 많을수록 높아진다.
    간단하게 Tm 값을 계산하는 공식으로
    Tm＝4(G＋C)＋2(A＋T)℃
    가 쓰인다. 보통 annealing 온도는 Tm 값보다 5℃ 정도는 낮게 잡아야 한다.
    또 하나의 중요한 문제는 annealing 온도가 너무 다른 primer들을 쌍으로 사용
    하였을 경우 증폭이 되지 않을 수도 있다. 대부분의 primer들은 annealing하는
    데 시간이 별로 걸리지 않아서 30초면 충분하지만 annealing온도가 Tm 값과
    비슷할 경우 시간이 많이 소요된다. 


    아래 사이트로 가시면  Tm을 예축하는 방법들이 있습니다. 참고

    http://www.promega.com/techserv/tools/biomath/calc11.htm#melt_results

     

    Theoretical Tm of Oligos

    There are several formulas for calculating melting temperatures (Tm). In all cases these calculations will give you a good starting point for determining appropriate annealing temperatures for PCR, RT-PCR, hybridization and primer extension procedures. However, a precise optimum annealing temperature must be determined empirically. 

    Basic Tm Calculations

    The simplest formula is as follows (1):

    Tm = 4°C  x  (number of G’s and C’s in the primer) + 2°C  x  (number of A’s and T’s in the primer)

    This formula is valid for oligos <14 bases and assumes that the reaction is carried out in the presence of 50mM monovalent cations. For longer oligos, the formula below is used:

    Tm =  64.9°C + 41°C x (number of G’s and C’s in the primer – 16.4)/N

    Where N is the length of the primer.

    For example, Promega’s T7 Promoter Primer (TAATACGACTCACTATAGGG) is a 20mer composed of 5 T’s, 7 A’s, 4 C’s, and 4 G’s. Thus, its melting temperature is calculated:

    64.9°C  +  41°C  x  (8  –  16.4)/20  =  47.7°C

     

    Salt-Adjusted Tm Calculations

    Another commonly used formula takes into account the salt concentration of the reaction (1–4). This formula has several variations, but all of them are essentially as follows:

    Tm =  81.5°C  +  16.6°C  x  (log10[Na+] + [K+])  +  0.41°C  x  (%GC)  –  675/N

    Where N is the number of nucleotides in the oligo. Note that PCR is typically performed in the presence of ~50mM monovalent cations.

    Using the same T7 Promoter Primer as an example in PCR with 50mM monovalent cation concentration, its Tm is calculated:

    81.5°C + 16.6°C  x  (log10[0.05])  +  0.41°C x (40)  –  675/20  =  42.5°C

    답변수정
    Primer의 길이와 염기서열이 증폭을 성공적으로 해낼 수 있는 가장 중요한
    관건이다. 핵산의 녹는점 (Tm) (여기서 녹는다는 의미는 두 가닥이 반 쯤 분리
    되는 것을 의미함)은 길이가 길수록, 그리고 (G+C)의 양이 많을수록 높아진다.
    간단하게 Tm 값을 계산하는 공식으로
    Tm＝4(G＋C)＋2(A＋T)℃
    가 쓰인다. 보통 annealing 온도는 Tm 값보다 5℃ 정도는 낮게 잡아야 한다.
    또 하나의 중요한 문제는 annealing 온도가 너무 다른 primer들을 쌍으로 사용
    하였을 경우 증폭이 되지 않을 수도 있다. 대부분의 primer들은 annealing하는
    데 시간이 별로 걸리지 않아서 30초면 충분하지만 annealing온도가 Tm 값과
    비슷할 경우 시간이 많이 소요된다. 


    아래 사이트로 가시면  Tm을 예축하는 방법들이 있습니다. 참고

    http://www.promega.com/techserv/tools/biomath/calc11.htm#melt_results

     

    Theoretical Tm of Oligos

    There are several formulas for calculating melting temperatures (Tm). In all cases these calculations will give you a good starting point for determining appropriate annealing temperatures for PCR, RT-PCR, hybridization and primer extension procedures. However, a precise optimum annealing temperature must be determined empirically. 

    Basic Tm Calculations

    The simplest formula is as follows (1):

    Tm = 4°C  x  (number of G’s and C’s in the primer) + 2°C  x  (number of A’s and T’s in the primer)

    This formula is valid for oligos <14 bases and assumes that the reaction is carried out in the presence of 50mM monovalent cations. For longer oligos, the formula below is used:

    Tm =  64.9°C + 41°C x (number of G’s and C’s in the primer – 16.4)/N

    Where N is the length of the primer.

    For example, Promega’s T7 Promoter Primer (TAATACGACTCACTATAGGG) is a 20mer composed of 5 T’s, 7 A’s, 4 C’s, and 4 G’s. Thus, its melting temperature is calculated:

    64.9°C  +  41°C  x  (8  –  16.4)/20  =  47.7°C

     

    Salt-Adjusted Tm Calculations

    Another commonly used formula takes into account the salt concentration of the reaction (1–4). This formula has several variations, but all of them are essentially as follows:

    Tm =  81.5°C  +  16.6°C  x  (log10[Na+] + [K+])  +  0.41°C  x  (%GC)  –  675/N

    Where N is the number of nucleotides in the oligo. Note that PCR is typically performed in the presence of ~50mM monovalent cations.

    Using the same T7 Promoter Primer as an example in PCR with 50mM monovalent cation concentration, its Tm is calculated:

    81.5°C + 16.6°C  x  (log10[0.05])  +  0.41°C x (40)  –  675/20  =  42.5°C

    등록된 댓글이 없습니다.
목록
목록